Rivestimenti in vetroceramica nanostrutturati per applicazioni ortopediche - Parte 3


2.2 Resistenza dell'incollaggio e micro-durezza

   La forza di adesione tensile tra rivestimento e   substrato   era   misurato   nel   conformità   con   ASTM   C-633-79.   Il   analisi   procedura   può   essere   trovato   nel   il nostro precedente lavoro [ 32 ]. Cinque campioni sono stati testati in modo indipendente   per   ogni   genere   di   rivestimenti   e   il   risultati   sono stati segnalati   come   significa ± sd

La micro-durezza dei rivestimenti è stata testata su superfici di rivestimento lucidate utilizzando un tester di micro-durezza Shimadzu (Shimadzu Co., Giappone) con un carico di 300 gf e   un   Caricamento in corso   tempo   di   15 s.   Prima   test,   rivestimenti   sono stati sottoposti   a   definire   lucidatura.   Durezza   valori   sono stati registrati   sopra   15   diverso   posizioni.  

Il   risultati   sono presentati   come   significare ± sd

 


Tabella 1. Primer utilizzati per marcatori RT-PCR-HOB correlati.


gene

sequenza   ( 5 '   - 3 ' )

temperatura di fusione (℃)

GAPDH

F ACCCAGAAGACTGTGGATGG

60


R CAGTGAGCTTCCCGTTCAG


Runx-2

F ATGCTTCATTCGCCTCAC

60


R ACTGCTTGCAGCCTTAAAT


OPN

F TTCCAAGTAAGTCCAACGAAAG

60


R GTGACCAGTTCATCAGATTCAT


collagene di tipo I

F AGGGTCCCAACGAGATCGAGATCCG

60


R TACAGGAAGCAGACAGGGCCAACGTCG


BSP

F ATGGCCTGTGCTTTCTCAATG

60


R GGATAAAAGTAGGCATGCTTG


 


2.3. Rilascio di ioni e test di mineralizzazione acellulare

     Per misurare i comportamenti di rilascio degli ioni dei rivestimenti HT e SP, sono stati immersi per 7 giorni in una soluzione di cloruro di sodio da 15 ml (pH 7,4) tamponata con tris (idrossimetil) amminometano e acido cloridrico (soluzione tamponata HCl -Tris). Dopo l'immersione, sono stati misurati i valori di pH della soluzione tamponata e le concentrazioni di ioni sono state testate mediante spettroscopia di emissione atomica al plasma a luce pulsata induttiva (ICP-OES, Optima 3000 DV, USA).

La capacità dei rivestimenti di indurre la precipitazione di composti di Ca e fosforo (P) è stata valutata immergendo rivestimenti in terreno di coltura privo di cellule. In breve, i rivestimenti sono stati sterilizzati mediante immersione in soluzione di etanolo al 70% durante la notte e quindi lavati con soluzione salina tamponata con fosfato (PBS) prima di immergere nel terreno di coltura. Tre millilitri di terreno di coltura sono stati aggiunti in ciascun pozzetto di piastra di coltura a 12 pozzetti contenente campioni di rivestimento. I campioni di rivestimento sono stati incubati a 37 in un'atmosfera umidificata al 5% di CO 2 per 5 ore, quindi lavati con acqua ultrapura, essiccati e polverizzati con carbone per osservazione SEM. La composizione chimica dei depositi formatisi sulla superficie di rivestimento dopo la mineralizzazione è stata analizzata utilizzando la spettroscopia a dispersione di energia (EDS), che è stata collegata allo strumento SEM.


2.4. Isolamento e coltura degli osteoblasti umani primari

L'autorizzazione all'uso del tessuto umano scartato è stata concessa dal Comitato per l'etica umana dell'Università di Sydney e il consenso informato è stato ottenuto. Gli osteoblasti umani primari (HOB) sono stati isolati dal normale osso trabecolare umano come descritto in precedenza [34]. In breve, l'osso è stato diviso in pezzi da 1 mm3, lavato più volte in PBS e digerito con tripsina allo 0,02 per cento (p / v) (Sigma-Aldrich, USA) in PBS, pH 7,4, per 90 min a 37 ℃. Le cellule sono state poi coltivate in un mezzo completo contenente un mezzo essenziale minimo (a-MEM, Gibco Laboratories, USA), integrato con siero fetale vitello inattivato al calore 10% (v / v) (FCS, Gibco Laboratories), 2 mM L-glutammina (Gibco Laboratories), tampone Hepes da 25 mM (Gibco Laboratories), piruvato di sodio 2 mM, 30 mg ml -1 penicillina, 100 mg ml -1 streptomicina (Gibco Laboratories) e 0,1 mM L-acido ascorbico fosfato sale di magnesio ( Wako Pure Chemicals, Osaka, Giappone). Le cellule sono state coltivate a 37 ℃ in un'atmosfera del 5% di CO 2 e i media sono stati rinfrescati ogni tre giorni. Al momento della confluenza, le cellule furono passate e quelle del passaggio 3 furono usate negli esperimenti.



2.5. Attaccamento cellulare e osservazione morfologica

Dopo che le cellule hanno raggiunto l'80-90% di confluenza, sono state tryp sinized utilizzando TrypLE Express (Invitrogen), successivamente centrifugate e sospese in mezzi completi per produrre una sospensione cellulare con una densità di 3,4 × 10 4 cellule per millilitro. Quindi, una sospensione cellulare da 1 mi è stata aggiunta in ciascun pozzetto di una piastra di coltura cellulare a 24 pozzetti contenente campioni di rivestimento. Dopo la coltura per 2, 5 e 24 ore, le cellule sono state fissate in una soluzione di paraformaldeide al 4% , post-fissate usando 1% di tetrossido di osmio in PBS per 1 ora, quindi disidratate in una soluzione di etanolo graduato (30, 50, 70, 90, 95 e 100%), e infine essiccati in esametildisilizano per 3 minuti. I campioni di rivestimento essiccati sono stati spruzzati con oro prima dell'osservazione SEM.



2.6. Saggio di proliferazione cellulare

L'analisi acquosa di CellTiter 96 (Promega, USA), un metodo colorimetrico, è stata utilizzata per determinare il numero di cellule vitali. Il saggio è una soluzione combinata di composto di tetrazolio 3- (4,5-dimetiltiazol-2-il) -5- (3-carbossimetossifenil) -2- (4-solfofenil-2H-tetrazolio) (MTS) e un reagente di accoppiamento elettronico (metasolfato di fenazina) con un rapporto in volume di 20: 1. Il precedente composto può essere bioreducato da cellule vitali in un formazano, che è solubile in terreno di coltura cellulare. Quindi, l'assorbanza del formazan a 490 nm è direttamente proporzionale al numero di cellule vitali. Quattro campioni di ciascun tipo di rivestimento sono stati testati per ciascun punto temporale e i dischi Ti-6Al-4V non rivestiti sono stati utilizzati come controllo. In breve, 1 ml di sospensione cellulare con una densità cellulare di 8,5 × 10 4 cellule ml -1 è stato aggiunto in ciascun pozzetto di una piastra di coltura a 24 pozzetti contenente i campioni di rivestimento. Dopo 3 e 7 giorni, il mezzo di coltura è stato sostituito da 700 ul della soluzione di lavoro MTS che era una soluzione diluita cinque volte del dosaggio acquoso CellTiter 96 in PBS. Dopo 4 ore di ulteriore incubazione, 100 ml della soluzione di lavoro sono stati trasferiti su una piastra di coltura cellulare a 96 pozzetti per misurare l'assorbanza utilizzando un lettore di micropiastre (PathTech) a 490 nm.


2.7. Reazione a catena della polimerasi quantitativa in tempo reale

HOBs sono stati seminati sui campioni di rivestimento a una densità cellulare di 2 × 10 4 cellule cm -2 e coltivati per 1 giorno e 7 giorni. Dopo ogni punto temporale, l'RNA totale è stato isolato da HOBs coltivato su campioni di rivestimento e campioni di controllo di dischi Ti-6Al-4V non rivestiti utilizzando Trizol (Sigma) seguendo le istruzioni del produttore. Il cDNA del primo filamento è stato sintetizzato da 0,7 ug di RNA totale utilizzando il kit Omniscript RT (Qiagen, USA) in base alle istruzioni del produttore. Il cDNA è stato quindi analizzato mediante PCR in tempo reale (Rotor-Gene 6000, Corbett Life Science) per i geni correlati agli osteoblasti: Runx-2, collagene di tipo I, osteopontina (OPN) e sialoproteina ossea (BSP) e relativa espressione genica i livelli sono stati ottenuti normalizzando la gliceraldeide 3-fosfato deidrogenasi (GAPDH).

I primer usati per i geni selezionati sono elencati nella tabella 1.


2.8. analisi statistica

I dati sono stati ottenuti da quattro esperimenti indipendenti ed espressi come media ± sd Per l' analisi statistica , è stato utilizzato il programma SPSS 17.0. Il test di Levene è stato eseguito per determinare l'omogeneità della varianza per tutti i dati, quindi i test post hoc di Tukey HSD sono stati utilizzati per i dati con varianza omogenea, altrimenti è stato utilizzato il T2 post hoc di Tamhane.

Un valore p inferiore a 0,05 è stato considerato significativo.



******continua******